|
XB-LIB-160
Library Name: NICHD_XGC_FaBN
|
Species: Xenopus laevis
|
Number Of Clones: 4720
|
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.2kb resulted in an average insert size of 1.5kb, and Cot value of 7. This is a normalized library (primary library is NICHD_XGC_FaB) and was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.
|
Normalized: No
|
Subtraction: No
|
|
Anatomy:
fat body
|
Stage:
|
| Vector Details | Vector Map | Name: pExpress-1
Type: plasmid
5' Restriction Site: EcoRV
3' Restriction Site: NotI |  |
|
[2.8.5]
