|
XB-CLONE-1589247
| Clone Name: IMAGE:8545890 | Gene: app.L | Species: Xenopus laevis | |
Sequence:
5' EST: EB468080
[+]
Library:
| Name: NICHD_XGC_tail_m | External Dbs: Unigene laevis cDNA library, Xenopus IMAGE cDNA Library |
Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25 kb resulted in an average insert size of 1.8 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.
| Anatomy: tail | Stage: NF stage 56 to NF stage 62 |
| Normalized: No | Subtraction: No |
| Vector Details | Vector Map | Name: pCS111 Type: plasmid 5' Restriction Site: SmaI 3' Restriction Site: NotI |
Usage:
Suppliers:
Search for clone at: Open Biosystems
