| miRNA Name: xtr-miR-124 | ![]() |
| Mature Sequence: UUAAGGCACGCGGUGAAUGCCA | |
| Full Sequence:
UAAGUCUCUG ACUCUCCGUG UUCACAGCGG ACCUUGAUUU AAUGUCAUAC AAUUAAGGCA CGCGGUGAAU GCCAAGAGUG
|
|
| miRBase: MI0004930 |
In Situ Images:
Cited Literature:
| MicroRNAs couple cell fate and developmental timing in retina. Decembrini S et al. 2009 |
| Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Lim LP et al. 2005 |
| FMR1/FXR1 and the miRNA pathway are required for eye and neural crest development. Gessert S et al. 2010 |
| MiR-124 regulates early neurogenesis in the optic vesicle and forebrain, targeting NeuroD1. Liu K et al. 2011 |
| MicroRNA miR-124 regulates neurite outgrowth during neuronal differentiation. Yu JY et al. 2008 |
| Stage-specific expression of microRNAs during Xenopus development. Watanabe T et al. 2005 |







