| miRNA Name: xtr-miR-126* | ![]() |
| Mature Sequence: CAUUAUUACUUUUGGUACGCG | |
| Full Sequence:
GGCUGUGCAU UAUUACUUUU GGUACGCGCU GUGUCACAUC AAACUCGUAC CGUGAGUAAU
|
|
| miRBase: MI0004827 |
In Situ Images:
Cited Literature:
| miRNA Name: xtr-miR-126* | ![]() |
| Mature Sequence: CAUUAUUACUUUUGGUACGCG | |
| Full Sequence:
GGCUGUGCAU UAUUACUUUU GGUACGCGCU GUGUCACAUC AAACUCGUAC CGUGAGUAAU
|
|
| miRBase: MI0004827 |