| miRNA Name: xtr-miR-25 | ![]() |
| Mature Sequence: CAUUGCACUUGUCUCGGUCUGA | |
| Full Sequence: | |
| miRBase: |
In Situ Images:
Cited Literature:
| Xenopus microRNA genes are predominantly located within introns and are differentially expressed in adult frog tissues via post-transcriptional regulation. Tang GQ et al. 2008 |



